Journal of Innovations in Pharmaceutical and Biological Sciences (JIPBS)
eISSN: 2349-2759 | pISSN: 2395-1095 | Vol. 4, Issue 2, 2017, pp. 58-67

Improvement of thermophilic α-amylase productivity through UV mutagenesis and AmyE gene amplification and sequencing

Khedr M.A.1, Emad A. Ewais1, Khalil K. M. A.2

1Botany and Microbiology Department, Faculty of science, Al- Azhar University, Cairo, Egypt
2Genetics and Cytology Department, National Research Center, Giza, Egypt
DOI: 10.56511/JIPBS.2017.v4.i02.pp58-67 | Published: 2017-04-05 | Article page and PDF

Abstract

Induction of mutation with UV was used to improve α-amylase enzyme production by Bacillus licheniformis MK90, an Egyptian isolate. One hundred eighty mutants were isolated after UV treatment for 3, 5, 7 and 10 min. Three mutants (UV-5-M3, UV-3-M17, and UV-5-M121) were higher α-amylase producers than parental strain and mutant UV-5-M121 was the highest producer one with 150.8% of WT productivity. Parental α-amylase has molecular weight equal 64 kDa while it was 65 kDa with UV-5-mutant 121 and 61 kDa with UV-5-mutant 3 through SDS-PAGE analysis. SDS-PAGE showed a high variance between the two mutants and WT, mutant UV-M3 showed 15 bands, UV-M121 showed 17 bands, while WT showed 18 bands. The best two producer mutants UV-5-m121 and UV-5-m3 proved its maximum production after 72h of fermentation at temperature 55 and 65°C with pH 7 and 8. Starch at 1.5% was the best concentration for the most mutants to reach their maximum productivity after 72h of fermentation. AmyE gene was amplified, and sequenced. It was 1539 bps in the three sequences. Mutant UV-5-m1 21 contains the lowest nucleotide substitution sites; it reached 5 only. While mutant UV-5-m3 contains seven substitutions compared with the parental sequence

Keywords: Bacillus licheniformis; α-amylase; AmyE gene; UV mutation; Genomic environmental interaction

Introduction

Bacterial amylases have longer shelf life and can be stored for weeks without significant loss of activity [1]. α- Amylases produced from thermophilic microorganisms were the ideal ones [2,3] since they are not usually denatured by high temperatures and are even active at elevated temperatures [4]. Production of amylases from bacteria is beneficial for human population as their starch degrading ability can be exploited for preparation of special food items, easily digestible for infants, patients, and elderly people [5-9]. Utilization of bacterial strains specifically from genus Bacillus is gaining momentum because of their ability to resist and survive under harsh industrial conditions [10].Genetically modified organisms are also being used for production of α-amylase. There are various methods by which microorganisms can be manipulated at a genetic level in order to improve and optimize the production of this enzyme [11].

Physical and chemical mutagens are promising and are used for inducing the high yielding strains [12]. For industrial usage, enzyme must be produced at low cost, reusable, and reproducible. To achieve this target many techniques have been developed for strain improvement. Strain improvement is usually carried out by mutating the microorganism that produces the enzyme by techniques such as classical mutagenesis, which involves exposing the microbe to physical mutagens such as X-rays, Ɣ-rays, UV rays, etc., and chemical mutagens such as NTG, EMS, EtBr, [13].

The PCR amplification of the α-amylase gene was 1887bp with an approximately 93.65% similarity with standard bacterial strain Bacillus subtilis [8]. The coding region for the AmyE gene from the Bacillus sp. BBM1 was identified by means of the BLASTX software [14].

Experimental

Materials and methods

Qualitative screening for α-amylase production

Screening for the enzyme productivity done on agar medium composed of 0.5g peptone, 0.1g KCl, 0.5g MgSO .7H O, 4 2 0.1 g (NH ) SO 0.1g NaH PO [15], 2g starch was added as 4 2 4 2 4 [16] recommended.

Amylase production was carried out in production medium containing (w/v) 6g bacteriological peptone, 0.5g MgSO .7H O, 0.5g KCl, 1g Starch and 1000 ml distilled 4 2 water [17]. The flasks were incubated at 50°C for 24 h under shaking. Whole broth was centrifuged at 10000 rpm for 15 minutes at 4°C. The clear supernatant (crude enzyme) was used for estimation of amylase activity. The isolates were routinely maintained on nutrient agar slants at 4°C.

Amylase assay

The enzyme activity was assayed following the method of [18] using 3,5-dinitrosalicylic acid. An enzyme blank with 3,5-dinitrosalicylic acid added before the addition of enzyme was used as control. The amount of reducing sugar released was quantified using 3,5- dinitrosalicylic acid with maltose as standard at 540 nm with a UV spectrophotometer. One unit of α-amylase activity was defined as the amount of enzyme releasing 1 μmol of maltose equivalent per minute from soluble starch at pH 7.0 when incubated at 50°C.

Partial purification of α-amylase

Partial purification of α-amylase method modified from [19] in which 4:1 cold acetone to sample added with constant stirring. The mixture was allowed to stand for 1h at 4°C and the enzyme fraction was dried over anhydrous calcium chloride under decreased pressure at room temperature. The fraction tested for enzyme activity and used for SDS step.

SDS-PAGE of whole cell proteins

Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described by [20-22]. Electrophoresis was performed at the constant current of 20 mA, using a 12 % separating gel (pH= 8.8) and 4 % stacking gel (pH=6.8).

UV-Mutagenesis

The UV irradiation was used to induce mutations in Bacillus licheniformis according to modified method of [23-26] where, cells suspension of overnight culture was prepared by shaking for five min. Cells were exposed to Ultraviolet Irradiation (UV) at a distance of 20 cm for 3, 5, 7 and 10 minutes. After irradiation the treated suspension protected from light for 1h by keeping in dark place. One ml from treated cells with suitable dilution was plated on LB, LB supplemented with starch and minimal starch [27].

Effect of substrate concentration on α-amylase production

Different substrate concentrations (0.5-1.5%) added to 250 ml conical flasks containing medium composed of (w/v) 6g peptone, 0.5g MgSO4.7H2O, 0.5g KCl, with 1.5 % maize starch. The conical flasks incubated for 24 hours at optimal pH and temperature for each mutant.

Effect of temperature and pH optima

The temperature and pH activity profiles for amylase from UV mutants was studied in the pH range of 6.0 to 9.0 by mixing the enzyme with sodium phosphate buffer (pH 6.0 and 7.0), Tris buffer (pH 8.0), and glycine-NaOH (pH 9.0 and 10.0) in the ratio 1:1 at different temperatures (35- 75°C) using optimal concentration starch for each mutant.

Genomic DNA extraction

Genomic DNA was isolated according Alkaline Method Kit [28]. In an eppendorf, 1.5 ml from overnight culture were taken, centrifuged at 8,000 x g for 1 min, pellet was kept and 250 μl of solution A was added, mixed by automatic pipette up and dawn. Then 250 μl of solution B was added and mixed by moving up and down three times. Then 250 μl of solution C was added and centrifuged at 13,000 x g for 5 min. Finally, the upper phase was removed into new eppendorf. After extraction of the DNA samples, an appropriate amount was transferred (about 25 μl) of each sample to a fresh eppendorf and 5μl of loading buffer was added.

Amplification and sequencing of α-amylase (AmyE) gene

Thermo cycler PCR used to amplify α-amylase coding gene (AmyE) with two primers, forward (MK-am.F) 5'- ATGAAACAACAAAAACGGCTTT-3' and Reverse (MK- am.R) 5' -CTATCTTTGAACATAAATTGAAACCG-3'. Bacillus licheniformis MK90 and the two mutants used as DNA template for amplification.

PCR cycle profile

The PCR performed with the following cycling profile:

◦ initial denaturation at 94 C for 5minutes, followed by 35 ◦ ◦ cycles of 1minute denaturation at 94 C, annealing at 52 C for 1 minute, and extension at 72◦C for 3minutes. The time for the final extension step was extended to 15 minutes. The PCR product was electrophoresed in 1% agarose horizontal slab gels. Gels were run at 112 V, and stained with Ethidium bromide for 30 minutes. The PCR product was purified and sequenced.

DNA sequence analysis

The sequencing reactions were carried out by Sanger Sequencing Technology on Applied Bio-systems automated DNA sequencer, model ABI 3730XL DNA Analyzer (Applied Bio-systems, USA; service provided by Macrogen Inc., South Korea). The sequence analyses and alignments were performed by NCBI-BLAST programs of the National Center for Biotechnology Information [14, 29-31] and DNA alignment was performed to compare between DNA of wild strain and the two selected mutants which show the best α- amylase productivity using Cluster W online software.

Results and Discussion

Induction and selection of mutation using UV irradiation

Local Egyptian Strain Bacillus licheniformis MK90 isolated from the internal soil of Pharaoh pools which characterized by its thermophilic nature, used as a Parental stain or WT coded on Genebank with accession number kt387748 was treated with UV radiation at wave length 254.5 for different periods of time 3, 5, 7 and 10 minutes and all the available colonies appeared after UV treatment (about 180 colonies) were picked up. Surviving ratio was decreased as the time of UV exposure increased; it recorded 100% without UV

Figure 1. percentage of surviving single colonies at different time of UV- exposure 3, 5, 7, and 10 min respectively at -1 concentration 10 .
Figure 1. percentage of surviving single colonies at different time of UV- exposure 3, 5, 7, and 10 min respectively at -1 concentration 10 .

All colonies grown on Starch agar medium tested for their ability to produce α-amylase. Mutants divided in to active and inactive α-amylase ones, inactive producers present 8.8% of the total selected mutants while active ones

Figure 2. Percentage of active and inactive mutants isolated after UV treatment.
Figure 2. Percentage of active and inactive mutants isolated after UV treatment.

As the second cycle of selection, mutants with clear zone diameter near or higher than parental strain tested again in starch agar and fermentation medium. Clear zone measured in starch agar medium and DNS chemical assay method used with mutants grown in fermentation medium (Table 1).

Twenty mutants were screened for their enzyme o productivity for 72h at 50 C; Productivity was varied than parental strain as shown in (Table 1) Out of twenty; five mutants were higher producer than parental strain after 24h of incubation, UV-3-M1, UV-5-M3, UV-5-M6, UV-3-M17 and UV-5-M121 with clear zone recorded as 28.1 mm (104%), 36 (133.3%), 29 (107.4%), 30 (111%) and 41mm (151.8%) respectively while parental strain had clear zone diameter 27mm (100%) (Table 1).

Table 1. Productivity of α-amylase by active UV- mutantson minimal Starch agar for 72h. UV- mutants Incubation time 24h 48h 72h
Table 1. Productivity of α-amylase by active UV- mutantson minimal Starch agar for 72h. UV- mutants Incubation time 24h 48h 72h

Clear zone was determined after addition iodine reagent within mm Twenty mutants out of 180 mutants isolated after UV treatment grown on fermentation medium supplemented with 1.5% starch as a carbon source. Three mutants (UV-5-

Figure 3. Productivity of α-amylase for 4 days by the three higher producer UV-mutants.
Figure 3. Productivity of α-amylase for 4 days by the three higher producer UV-mutants.

The mutant U 2-6 was more thermostable and more enzyme productivity than parental strain Bacillus subtilis with 36% [32]. It was reported that Keratinase productivity by mutant Bacillus Subtilis FUN 30.2 was improved 75.93% than parental strain through UV mutation [33]. Bacillus mutant zones measuring 14-15 mm on the milk casein agar compared with wild strain RS zones 10-12 mm [34]. Enhancement of amylase, cellulase, and lipase activity was observed in all the strains after fungal strain exposure to UV radiation [35].

SDS PAGE

Extracellular protein analysis

UV-m-121 α-amylase has molecular mass of 65 kDa while α-amylase from UV-m-3 has molecular mass of 61 kDa and α-amylase from WT of 64 kDa by SDS-PAGE, It similar to [36] result. Amylase detected as a single band with 65 kDa by SDS polyacrylamide gel electrophoresis [37]. The α- amylase from Bacillus licheniformis EMS-6 was a single band and when purified, it showed 55 kDa by FPLC [11]. The purified α-amylases from Bacillus subtilis and mutant U 2-6 strain were 56 kDa molecular weight [32] (Figure 4).

Figure 4. SDS-PAGE for extracellular proteins of parental strain and the two higher producer UV-mutants, were Lane 1: marker broad range, Bio-Rad within α-amylase has 66 KDa); Lane 2: extracted proteins of UV-5-M121; Lane 3:
Figure 4. SDS-PAGE for extracellular proteins of parental strain and the two higher producer UV-mutants, were Lane 1: marker broad range, Bio-Rad within α-amylase has 66 KDa); Lane 2: extracted proteins of UV-5-M121; Lane 3:

extracted proteins of UV-5-M3; Lane 4: extracted proteins of parental strain (WT).

Total cellular protein analysis

Total protein bands of mutants and parental strain on SDS- PAGE were analyzed by Gel Analyzer 2010 software. A high variance was notice between the two mutants and WT, mutant UV-M3 showed 15 bands, UV-M121 showed 17 bands. The WT showed 18 bands. SDS-PAGE with protein marker performed and results presented in (Figure 5).Total protein bands of mutants and parental strain on SDS-PAGE analyzed by Gel Analyzer 2010 software. A high variance was notice between the two mutants and WT, mutant UV- M3 showed 15 bands, UV-M121 showed 17 bands, and the WT showed 18 bands.

The interaction between genomic of selected mutants and different environmental conditions Effect of incubation period in α-amylase production

Six higher producing mutants resulted from UV treatment selected as promising mutants beside parental strain, tested for their enzyme productivity in the production medium

Figure 5. SDS-PAGE for total proteins extracted from W.T. and the best two mutants resulted from UV and EtBr manipulation was: Lane 1: marker broad range, Bio-Rad); Lane 2: extracted proteins from UV-M3; Lane 3: extracted
Figure 5. SDS-PAGE for total proteins extracted from W.T. and the best two mutants resulted from UV and EtBr manipulation was: Lane 1: marker broad range, Bio-Rad); Lane 2: extracted proteins from UV-M3; Lane 3: extracted

proteins from UV-M121; Lane 4: extracted proteins from parental strain.

Three mutants proved their higher productivity than parental strain after 24h, UV-mutant-3, UV-mutant-17, UV-mutant121, their productivity were 6010 (127.8%), 5510 (127.87%), and 6800 (144.68%), respectively. These three mutants showed slightly decreasing in their productivity after 48h till the end of incubation, except UV-mutant-121, increased after 48h of incubation and slightly decreased till 7200IU/ml till the end of incubation (Table 2).

Mutant UV-5-m121 was the best enzyme producing mutant with 7210 (180.2%) compared with the parental strain with 4000 IU/ml (100%). It reached its maximum productivity after 72h. While, maximum α-amylase productions were achieved at the end of 12 h of growth for alkaline, and thermophilic Bacillus sp. strain KH-13 (WT) and its mutant KH13-M3 [38].

Mutant UV-5-m 121 was the best enzyme producer with 7300 IU/ml (155.31%) compared with the parental strain with 4700 IU/ml (100%). It reached its maximum productivity after 72h.

Effect of temperature in α-amylase production

The selected mutants tested using five different temperatures for maximum production of α-amylase production, 35, 45, o 55, 65, and 75 C. Parental strain selected as a thermophilic isolate isolated from internal soil of Pharaoh Pools, the selected mutants from it keep on their character, none of tested mutants beside the parental strain prove its maximum o productivity at 35 C (Table 3).

Only one mutant, UV-3-m130 showed its maximum o productivity at 45 C while two mutants UV-3-m17, and o UV-3-m92 reached their maximum productivity at 55 C (Table 3). Three mutants beside parental strain proved their

Table 2. Enzyme productivity by the best selected UV- mutants and their parental strain for 96 h.
Table 2. Enzyme productivity by the best selected UV- mutants and their parental strain for 96 h.
Table 3. Enzyme productivity of WT and the best UV mutants at different temperature.
Table 3. Enzyme productivity of WT and the best UV mutants at different temperature.
Table 4. enzyme productivity of WT and the selected mutants at different pH values Mutants pH6 pH7 pH8 pH9 UV-5-m3 3520 4910 UV-3-m17 3470 4030
Table 4. enzyme productivity of WT and the selected mutants at different pH values Mutants pH6 pH7 pH8 pH9 UV-5-m3 3520 4910 UV-3-m17 3470 4030

the highest producer mutant showed its maximum productivity at this temperature was UV-5-m3 (Table 3) The optimum temperature for α-amylases of alkaline and thermophilic Bacillus sp. strain KH-13 (WT) and its mutant KH13-M3 was 40 and 50°C, respectively [38]. Better α- amylase enzyme activity of Bacillus amyloliquefaciens EMS-6 mutant was at 37ºC for 24 to 72h incubation times [11]. The enzyme activity was increased with fermentation period increased. The maximum α-amylase production (60.9 U/ml/min) was at 37ºC in 48 h. When the temperature was increased up to 43ºC, the enzyme activity markedly declined.

The α-amylase production by the Streptomyces clavifer AM-7-1-4 mutant was affected by different environmental factors. The optimum condition was 60°C. Sufficient activity (≥ 86%) was also observed at temperature ranged from 50 to 65°C, respectively [39].

UV Mutant number 17 of Bacillus mojavenis PTCC 1723 produces 330.56 IU/ml xylanase. It was 3.45 times more enzyme than the wild strain with 95.73 IU/ml. Optimization resulted 575 IU/ml xylanase, with wheat bran as the best carbon source, corn steep liquor as the best nitrogen source accompanied with natural bakery yeast powder, in a medium with pH 7, after 48 hr incubation at 37°C, and the shaking rate of 230 rpm [40].

Effect of pH in α-amylase production

Six mutants beside WT tested for their ability to produce α- amylase in different pH, 6, 7, 8, and 9.

Four mutants reached their maximum productivity at pH 7 beside WT, it also prove its maximum productivity at this pH. Mutant UV-5-m121 prove its maximum productivity at pH 7, it's also the third highest producing mutant in the level of all tested thirteen mutants. Two mutants out of six, proved their maximum productivity at pH 8. They were UV-5-m3 and UV-3-m92 Table (4). The highest producing mutant out of them at pH 8, was UV-5-m3, it produce 5620 IU/ml which nearly 138% compared with WT.

The α-amylase production by the Streptomyces clavifer AM-7-1-4 mutant was affected by different environmental factors, such as pH and temperature [39]. It was observed that the optimum condition was pH 6 and 60°C. Sufficient activity (≥ 86%) was also observed at pH range 5.5 to 6.5.

Table 5. Enzyme productivity by the best UV-mutants and their parental strain at different starch concentrations. Mutants 0.50% Starch 1% Starch 1.50% Starch 24h 48h 72h 24h 48h 72h 24h 48h 72h UV-5-m3 4000 4170 4170 4630 4790 4850 6300 6210 6100
Table 5. Enzyme productivity by the best UV-mutants and their parental strain at different starch concentrations. Mutants 0.50% Starch 1% Starch 1.50% Starch 24h 48h 72h 24h 48h 72h 24h 48h 72h UV-5-m3 4000 4170 4170 4630 4790 4850 6300 6210 6100

ATGAAACAACACAAACGGCTTTATGCCCGATTGCTGCCGCTGTTATTTGCGCTCATCTTCTTGCTGTCTC AGCGGCGGCAAGTCTTAATGGGACGCTGATGCAGTATTTTGAGTGGTACATGCCAAATGATGGCCAACATTGGAAACG CTTACAAAATGACTCGGCATATTTGGCTGAACACGGTATTACTGCCGTCTGGATTCCCCCGGCATATAAGGGAACGAGT CAAGACGATGTAGGCTACGGCGCTTACGATCTGTATGATTTAGGGGAGTTTCATCAAAAAGGGACGGTTCGGACAAAG GGGAGAACTGCAATCTGCGATCAACAGTCTTCATTCCCGGGACATCAACGTTTACGGCGATGTAGTCA TCAACCACAAAGGCGGCGCTGATGCGACCGAAGATGTAACGGCTGTTGAAGTCGATCCCGCTGACCGCAACCGCGTAA CATCAGGAGAACAGCGAATCAAAGCGTGGACACATTTTCAATTCCCGGGGCGCGGCAGCACATACAGCGATTTCAAAT GACGAGTCCCGAAAGCTGAACCGCATCTATAAGTTTCAAGGAAAGG CATGGGATTGGGAAGTTTCCAATGAAAACGGCAACTATGATTACTTGATGTATGCCGACATCGATTATGATCATCCTGA TGTCACGGCAGAAATAAAGAGATGGGGAACGTGGTATGCCAATGAGCTGCAATTGGACGGATTCCGCCTTGATGCCGT CAAACACATTAAATTTTCTTTTTTGCGGGATTGGGTCAATCATGTCAGGAAAA GCTGAATATTGGCAGAATGACTTAGTGCGCTGGAAAACTATTTTGAACAAAACAAACTTTAATCATTCAGTGTTTGACG TGCCGCTTCATTACCAGTTCCATGCTGCATCGACACAGGGAGGCGGCTATGATATGAGGAAATTGCTGAACGGAACAGT CGTTTCCAAGCATCCTGTGAAAGCGGTTACGTTTGTTGATAACCATGATACACAGCCGGGGCAATCGCTTGA GTCCAAACATGGTTTAAGCCGCTGGCTTACGCTTTTATTTTGACAAGAGAAGCAGGCTACCCGCAGATTTTCTACGGGG ATATGTACGGGACGAAAGGAGCCTCGCAGCGCGAAATTCCTGCCCTCAAACACAAAATCGAACCGATCTTAAAAGCGA GAAAACAATATGCGTACGGAGCACAGCATGATTATTTCGATCATCATAACATTGTCGGCTGGACGAGAGAAGGCGACA 1.5% starch concentration was the best one for the maximum enzyme productivity by all mutants and UV-5- m3 was the highest producing mutant; it reached its maximum productivity after 24h with 6300 IU/ml (168.4%) compared with W.T (Table 5).

Bacillus mutant strain RS1 isolated after UV irradiation showed 14-15 mm clearing zones on the milk casein agar indicating the presence of a protease, after the plates spotting with 10 μl cultures and incubated at 30°C for 48 hr but wild strain zones were 10-12 mm [34].

AmyE gene amplification and sequencing

In this study, parental strain Bacillus licheniformis MK90 and the best two mutants isolated after UV treatment, used for AmyE sequencing gene, coding for α-amylase enzyme.

The designed forward (MK-am.F) 5ATGAAACAACAA AAACGGCTTT3 and reverse (MK-am.R) 5-CTATCTT TGAACATAAATTGAAACCG3 primers used for amplifying AmyE gene by PCR using the two mutants and their parental strain DNA as a template. PCR products loaded in agarose gel electrophoresis with DNA ladder. Gel

(A) WT

TACGGCACAAA GGCATTGGTACCATTTTGACGGAACCGATTGG

Figure 6. Agarose gel electrophoresis showed PCR product of amyE gene (1500-1600 bps) using specific Forward (MK- am.F) and Reverse primers (MK-am.R). Lan 1: WT, Lan 2: UV-5-m3, Lan3: UV-5-m121 and Lan 4: DNA marker.
Figure 6. Agarose gel electrophoresis showed PCR product of amyE gene (1500-1600 bps) using specific Forward (MK- am.F) and Reverse primers (MK-am.R). Lan 1: WT, Lan 2: UV-5-m3, Lan3: UV-5-m121 and Lan 4: DNA marker.

ACTCTGCAGC AACAGGGAAAGGAAATGTTTACGGTA GTCGACT

Figure 7. The draft of AmyE gene sequences from the WT and the best two UV producing mutants
Figure 7. The draft of AmyE gene sequences from the WT and the best two UV producing mutants

Online BLAST analysis through NCBI site revealed that, 99 % homology between PCR products and standard α- amylase gene. In (Table 6), strain Bacillus licheniformis with accession number AF438149.1, has identity 99% in its sequence with the four mutants and their parental stain sequences, its AmyE gene coded for thermostable α- amylase enzyme, like the gene sequences under study.

The three sequences then analyzed using BLAST program to detect the differences between the two mutants and the parental strain due to UV effect, using online multiple alignment ClusterW and Jalview software.

Nucleotide sequences of AmyE gene of the parental strain and its two mutants compared to each other using online Cluster W and the results analyzed via jalview Version 2 (a multiple sequence alignment editor and analysis workbench) and many nucleotide substitutions were present in each mutant and these substitutions differ from parental strain nucleotide sequence. Mutant UV-5-m121 contains the lowest substitution sites reached 5 only between 486 and 765, beside range between 958 and 1480, while mutant UV- 5-m3 contains substitutions reached seven between nucleotide number 546 and 837 (Figure 8).

Table 6. Top 10 hits description on the query of Sanger sequence for α-amylase gene (AmyE) of Bacillus licheniformis MR90 on BLAST.
Table 6. Top 10 hits description on the query of Sanger sequence for α-amylase gene (AmyE) of Bacillus licheniformis MR90 on BLAST.

the highest alignment score (Max score) from that database sequence, the best (the lowest) Expect value (E value) of all alignments from that database sequence,

Figure 8. DNA alignment between AmyE gene sequence from parental strain and the two mutants using Jalview software which showed that AmyE gene composed of 1539 bps.
Figure 8. DNA alignment between AmyE gene sequence from parental strain and the two mutants using Jalview software which showed that AmyE gene composed of 1539 bps.

7 2809 Bacillus licheniformis gh13A gene for α- amylase , complete cds 8 Bacillus licheniformis strain SHG10 α- amylase 2676 gene, complete cds 9 Bacillus licheniformis strain AR1 α- amylase 2289 (amyL) gene, complete cds 10 Bacillus licheniformis strain ATCC 27811 α- 2283 amylase (amyA) gene, complete cds (a) (b) the description/title of matched database, (d) alignment scores(Total score) from all alignment segments, the percentage of query covered by alignment to the database (e) sequence, (g) identity (Max identity) of all query-subject alignments and the accession of the matched database sequence.

2809 100% 0.0 99% AB643493.1 2676 100% 0.0 98% JN853583.1 2289 100% 0.0 94% KJ508878.1 2283 100% 0.0 93% AY630336.1 (c) the total (f) the highest percent

Figure 9. Multiple alignments of Amino acid sequence for parental strain and the best four mutants.
Figure 9. Multiple alignments of Amino acid sequence for parental strain and the best four mutants.

The amyAgene from thermophilic Halothermothrixorenii was 1545 bps long, and encoded a 515 residue protein composed of a 25 amino acid putative signal peptide and a 490 amino acid mature protein. It possessed the five consensus regions characteristic of the α-amylase family and showed the greatest homology to the Bacillus megaterium group of a-amylases [41]. The nucleotide sequence of DNA fragments of gene coding heat-stable and pH-stable α- amylase of Bacillus licheniformis 584 (ATCC 27811) was 1948 bps containing the entire amylase gene was determined [42].

Amino acid sequence analysis of AmyE gene expression

The three sequences of parental strain and its two mutants analyzed via Snapgene viewer version 3.1.2. Software in which, nucleotide sequence of genes translated into amino acid sequences to observe the effect of UV in the gene expression and resulted enzyme.

The results showed that, the three sequences coding 513 amino acids but with some amino acid substitutions in the sequences of two mutants when compared with parental strain (Figure 9).

Sequence of mutant UV-5-m121 showed only one amino acid substitution in amino acid number 494, it replaced by Tryptophan while it was Glutamic acid in the parental sequence (Figure 9).

Mutant UV-5-m3 sequence showed three amino acid substitutions in sites 189, 279 and 280, these amino acids changed to Asparagine, Threonine, and Proline while they were in the parental sequence, Phenylalanine, Lysine and

Conclusion

Selected mutants isolated from Bacillus licheniformis MK90 after UV treatment showed higher α-amylase productivity. UV-5-M121 mutant was the highest producer with 150.8% compared with WT productivity. UV mutants produced a thermophilic α-amylase. The interaction between genomic of selected mutants and different environmental conditions were studied. Optimum condition for α-amylase production We concluded that, all substitutions in amino acid replacement with different amino acid as the effect of UV treatment could be classify as missense mutation (Table 7). As inferred from the DNA sequence, the B. licheniformis α- amylase had a signal peptide of 29 amino acid residues and the mature enzyme comprised 483 amino acid residues, giving a molecular weight of 55,2 kDa. The amino acid sequence of B. licheniformis α-amylase showed 65.4% and 80.3% homology with those of heat-stable Bacillus stearothermophilus α-amylase and relatively heat-unstable Bacillus amyloliquefaciens α-amylase, respectively [42].

Table 7. Amino acids substitution in UV-mutants in comparison with WT Amino acid No WT UV-5-m3 UV-5-m121 150 P P P
Table 7. Amino acids substitution in UV-mutants in comparison with WT Amino acid No WT UV-5-m3 UV-5-m121 150 P P P

Asparagine, K: Lysine, I: Isoleucine, H: Histidine, T:

Threonine, G: Glycine, Q: Glutamine, L: Leucine, A:

Alanine, E: Glutamic acid and W: Tryptophan.

PAGE analyzed showed high variance between the two mutants and WT. Mutant UV-M3 showed 15 bands, UV- M121 showed 17 bands and WT 18 bands. A thermophilic α-amylase gene (AmyE) of in Bacillus licheniformis MK90 and its two mutant’s sequences showed 1539 bps and this sequence coding for 513 amino acids. Many nucleotide substitutions were present in each mutant and differ than parental strain nucleotide.

References

References

  1. Bosch J.A, Veerman D.E, Geus E.J.: Proctor G.B. Α - amylase as a reliable and convenient measure of sympathetic activity: Psychoneuroendocrinology 2011; 36 (4):449–453.
  2. Raul, D., Biswas, T., Mukhopadhyay, S., Das, S.K. and Gupta. S: Production and partial purification of alpha amylase from Bacillus subtilis (MTCC 121) using solid state fermentation. Biochem. Res. J. 2014; 1-5.
  3. Shafaat, S., Akram, M. and Rehman, A. Isolation and characterization of a thermostable α-amylase from Bacillus subtilis. Afr. J. Microbiol. Res. 2011; 5:3334-3338.
  4. De souza P.M., Magalhaes P.O.: Application of microbial alpha amylases in industry : a review. Braz J. Microbiol 2010; 41: 850-861.
  5. Rick, W., and Stegbauer, H.P: Alpha amylase measurement of reducing groups. In H.U. Bergmeyer (ed) Methods of enzymatic analysis, 2nd Ed. Verlag Chemie, Weinheim 1974; 885-915.
  6. Vijayabaskar, P., D. Jayalakshmi and Shankar, T.: Amylase production by moderately halophilicBacillus cereus in solid state fermentation. Afr. J. Microbiol. Res. 2012; 6(23):4918-4926.
  7. Asgher, M.; Asad, M.J.; Rahman, S.U.; Legge, R.L.: A thermostable alpha-amylase from a moderately thermophilic Bacillus subtilis strain for starch processing. J. Food Process Eng. 2007; 79: 950 - 955.
  8. FahimehAfzal-Javan and Mohsen Mobini-Dehkordi: Amplification, Sequencing and Cloning of Iranian Native Bacillus subtilis Alphaamylase Gene in Saccharomyces cerevisiae. Jundishapur J Microbiol. 2013; 6(8):1-7, e7371.
  9. Vengadaramana A.: Industrial important microbial alpha amylase on starch converting-process. SchAcad J Pharm 2013; 2:209- 221.
  10. Maria G.; Asma A.; Afsheen A.; Rashida R. Z.; Nadir N. S. and Qader U: Isolation and characterization of different strains of Bacillus licheniformis for the production of commercially significant enzymes. Pak. J. Pharm. Sci. 2013; 26: 691-697.
  11. Haq I.; javed M. M. and Adnan F. Hameed U.: Kinetics and thermodynamic studies of alpha amylase from bacillus licheniformis mutant. Pak. J. Bot. 2010; 42(5): 3507-3516.
  12. Sidney PC, Nathan OK: Compositions and Uses for an Alpha-Amylase Polypeptide of Bacillus Spp. Meth. In Enz. 1975; 3: 26.
  13. Parekh, S., Vinci, V.A. Strobel, R.J.: Improvement of microbial strains and fermentation processes. App. Microbiol. Biotechnol. 2004; 54: 287-
  15. Altschul S. F.; Gish W.; Miller W.; Myers E. W and Lipman D. J.: Basic local alignment search tool. J Mol Biol. 1990; 215 (3): 403-410.
  16. Srivastava R. K. and Baruah J. N.: Culture conditions for production of thermostable amylase by Bacillus stearo thermophilus. Appl. Environ. Microbiol. 1986; 52: 179-184.
  17. Sasmita Mishra and Niranjan Behera.: Amylase activity of a starch degrading bacteria isolated from soil receiving kitchen wastes. African Journal of Biotechnology 2008; 7: 3326-3331.
  18. Sudha: Effect of different concentrations of metal ions on alpha amylase production by Bacillus amyloliquefaciens. Research in Biotechnology 2012; 3: 67-71
  19. Miller, G. L.: Use of dinitrosalicylic acid reagent for determination of reducing sugars. Anals. Chem. 1959; 31: 426-428.
  20. Singh M.; Abhishek Raj Gupta, and Akhilesh Kushwaha.: Amylase Production & Purification from Bacteria Isolated from a Waste Potato Dumpsite in District Farrukhabad U.P State India. European Journal of Experimental Biology 2011; 3: 107-113.
  21. Laemmli, U. K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227(5259): 680-685.
  22. Harlow E. and Lane D.: Antibodies: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.1988.
  23. Sambrook, J and David W. Russell.: SDS-Polyacrylamide Gel Electrophoresis of Proteins.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.2001.
  24. Khalil K. M. A.: Genetic Improvement of Streptomyces clavuligerus for Clavulanic acid and Cephamycin C antibiotic production by UV induced mutants, using a genetic constructed strain as tester. Egypt. J. Biotechnol. 2003; 15: 132-150.
  25. Khalil, K. M. A.: Transposon (Tn5) and UV irradiation as Mutagenic agents for Improving Photorhabdus sp. Sinai 1(S1), an Insect-pathogenic Bacterium. Bull. NRC. Egypt 2003; 28: 473-496.
  26. Ghazal, S.M. A., W. S. Elsayed, U. M. Badr, H.M. Gebreel and K. M. A. Khalil.: Genetically Modified Strains of Xanthomonascampestris Higher Xanthan Producer and Capable to Utilize Whey. Current Research in Bacteriology 2011; 4(2): 44-62.
  27. Sheldon G. Hurst IV, Shimaa Ghazala, Krystalynne Morris, Feseha Abebe-Akele, W. Kelley Thomas, Usama M. Badr, Mona A. Hussein, Mohamed A. Abou Zaied, Kamal M. Khalil, and Louis S. Tisa.: Draft Genome Sequence of Photorhabdustemperata strain Meg1, an Entomopathogenic Bacterium Isolated from Heterorhabditismegidis Nematodes. Genome Announc.November/December 2014; 2 01273-14.
  28. Witkin, E. M. Ultraviolet-induced mutation and DNA repair. Annual Rev. Genet. 1969; 487-514.
  29. Khalil K. M. A.: Bacterial Total DNA Isolation by Alkaline Method Using Kit, Egyptian Patent Office, Academy of Scientific Research & Technology 2011; Patent No: 25295.
  30. Stultz, C.M.; White, J.V. and Smith, T.F.: Structure analysis based on state-space modelling. Protein Sci. 1993; 2: 305-314.
  31. Hobohm, U. and Sander, C.: A sequence property approach for sequencing protein databases. J Mol Biol. 1995; 251(3): 390-399.
  32. Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller,W. and Lipman, D.J.: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997; 25: 3389-3402.
  33. Elif D: Production, purification, and characterization of α-amylase by Bacillus subtilis and its mutant derivates. Turk J Biol 2011; 35: 705-712.
  34. Xin Zhang: Applying the mutation of Bacillus subtilis and the optimization of feather fermentation medium to improve Keratinase activity. Advances in Biological Chemistry 2012; 2, 64-69.
  35. NehaKarn and Santosh Kumar Karn.: Evaluation and Characterization of Protease Production by Bacillus Sp. Induced By UV-Mutagenesis. Karn N, Karn SK EnzEng, 2014; 3.
  36. Prabakaran M.; Thennarasu V.; Ayeswariya R. Mangala, Bharathidasan R.; Chandrakala N. and Mohan N.: Comparative studies on the enzyme activities of wild and mutant fungal strains isolated from sugarcane field. Indian Journal of Science and Technology 2009; 2: 46-49.
  37. Yang, C. H. and Liu, W. H.: Cloning and characterization of a maltotriose-producing α -amylase gene from Thermobifidafusca. J. indust. Microbiol. Biotechnol. 2007; 34: 325-330.
  38. Murakami, S., Nishimoto, H., Toyama, Y., Shimamoto, E., Takenaka, S., Kaulpiboon, J., Prousoontorn, M., Limpaseni, T., Pongsawasdi, P. and Aoki, K.: Purification and characterization of two alkaline, thermotolerant α -amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli. Biosci. Biotechnol. Biochem. 2007; 71: 2393-2401.
  39. Fakhraddin Khodayari, Zeynel Cebeci, Bahri Devrim Ozcan.: Optimization of Xylanase and α-Amylase Production by Alkaline and Thermophilic Bacillus Isolate KH-13. Journal of Entomology and Zoology Studies 2014; 2 (5): 295-303.
  40. Mahmoud A. Y. and Hani Z. A.: Improved production, purification and some properties of α-amylase from Streptomyces clavifer. African Journal of Biotechnology 2012; 11(80):14603-14611.
  41. Ghazi, S.; Abbas A. S.; Mehrdad A.; Khosro K. and Ramazanali K: UV mutagenesis for the overproduction of xylanase from Bacillus mojavensis PTCC 1723 and optimization of the production condition. Iran J Basic Med Sci. 2014; 17:844-853.
  42. Benjamin N. Mijts and Bharat K. C. Patel: Cloning, sequencing and expression of an α- amylase gene, amyA, from the thermophilic halophile Halothermothrixorenii and purification and biochemical characterization of the recombinant enzyme. Microbiology 2002; 148, 2343–2349.
  43. Yuuki, T.; Nomura T.; Tezuka H.; Tsuboi A.; Yamagata H.; Tsukagoshi, N. and Udaka S. Complete Nucleotide Sequence of a Gene Coding for Heat and pH-Stable α-Amylase of Bacillus licheniformis: Comparison of the Amino Acid Sequences of Three Bacterial Liquefying α-Amylases Deduced from the DNA Sequences. J. Biochem. 1985; 98: 1147-1156.